Review



iscript reverse transcriptase master mix  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Qiagen iscript reverse transcriptase master mix
    Iscript Reverse Transcriptase Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 6786 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcriptase+master+mix/Reverse+transcriptase/bio_rxiv__2023__10__13__562147-281-31-15
    Average 97 stars, based on 6786 article reviews
    iscript reverse transcriptase master mix - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    Quantitative RT-PCR:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    Biomarker Discovery:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    Extraction:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    Transfection:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    cDNA Synthesis:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    Reverse Transcription:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.

    SYBR Green Assay:

    Article Title: The H3.3 K36M oncohistone disrupts the establishment of epigenetic memory through loss of DNA methylation
    Article Snippet: .. RT-qPCR for siRNA validation was performed by extraction of RNA using the RNeasy Mini kit (Qiagen 74104) according to the manufacturer’s recommendations 24hr post siRNA transfection. cDNA synthesis was performed using iScript reverse transcriptase master mix (Biorad 1708840). qPCR was performed using SSO Advanced SYBR Green master mix (Biorad 1725271) on a CFX Connect Real-Time PCR system (Biorad 1855201). qPCR primers used for DNMT3A and DNMT3B respectively are as follows: D3A FWD#2 5’ TCTGGAGCATGGCAGGATAG 3’ D3A REV#2: 5’ AAATGCTGGTCTTTGCCCTG 3’ D3B FWD#1 5’ TTGCTGTTGGAACCGTGAAG 3’ D3B REV#1 5’ CCGCCAATCACCAAGTCAAA 3’ .. Cell growth quantification was performed using the ViaFluor 488 SE cell proliferation dye in minCMV reporter HEK293T cells (Biotium 30086) or CellTrace Far-Red proliferation dye in pEF reporter TC28a2 cells (Thermo C34564) according to manufacturer’s instructions.



    Similar Products

    97
    Qiagen iscript reverse transcriptase master mix
    Iscript Reverse Transcriptase Master Mix, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcriptase+master+mix/Reverse+transcriptase/bio_rxiv__2023__10__13__562147-281-31-15
    Average 97 stars, based on 1 article reviews
    iscript reverse transcriptase master mix - by Bioz Stars, 2026-10
    97/100 stars
      Buy from Supplier

    90
    Bio-Rad iscript reverse transcriptase master mix
    Iscript Reverse Transcriptase Master Mix, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcriptase+master+mix/iscript+reverse+transcription+supermix/pm37524376-75-10-15
    Average 90 stars, based on 1 article reviews
    iscript reverse transcriptase master mix - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    99
    Qiagen ar signaling qiagen 330231 iscript reverse transcriptase biorad 1708841 power sybr green pcr master mix life technologies 4368708 deposited data raw
    Ar Signaling Qiagen 330231 Iscript Reverse Transcriptase Biorad 1708841 Power Sybr Green Pcr Master Mix Life Technologies 4368708 Deposited Data Raw, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/iscript+reverse+transcriptase+master+mix/Reverse+transcriptase/pmc06886683__NIHMS1544229___supplement___3-290-75-77
    Average 99 stars, based on 1 article reviews
    ar signaling qiagen 330231 iscript reverse transcriptase biorad 1708841 power sybr green pcr master mix life technologies 4368708 deposited data raw - by Bioz Stars, 2026-10
    99/100 stars
      Buy from Supplier

    Image Search Results